View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5666-Insertion-6 (Length: 241)
Name: NF5666-Insertion-6
Description: NF5666
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5666-Insertion-6 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 6 - 241
Target Start/End: Complemental strand, 52583496 - 52583261
Alignment:
| Q |
6 |
cacggacctgtgttgaattggaggatttggatggcttgcacggataatccaagcgccccgccggaaagttgatactgcgtgtatgagattttgattgtga |
105 |
Q |
| |
|
|||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52583496 |
cacggacctgtgttgaatcggacgatttggatggcttgcacggataatccaagcgccccgccggaaagttgatactgcgtgtatgagattttgattgtga |
52583397 |
T |
|
| Q |
106 |
agttgaattgttctcggcaagtaatggcggtttgaaaaaattgcggggagtacagggtcacttatggctgtcatcatgctttcagaaaaattgcagccaa |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
52583396 |
agttgaattgttctcggcaagtaatggcggtttgaaaaaattgcggggagtacagggtcacttatggctatcatcatgctttcagaaaaattgcagccaa |
52583297 |
T |
|
| Q |
206 |
agggaaaacaccgctcaaaaaatacaaccagagatg |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
52583296 |
agggaaaacaccgctcaaaaaatacaaccagagatg |
52583261 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 174 - 205
Target Start/End: Complemental strand, 39977616 - 39977585
Alignment:
| Q |
174 |
tgtcatcatgctttcagaaaaattgcagccaa |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
39977616 |
tgtcatcatgctttcagaaaaattgcagccaa |
39977585 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University