View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5666_high_1 (Length: 774)
Name: NF5666_high_1
Description: NF5666
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5666_high_1 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 179; Significance: 3e-96; HSPs: 5)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 179; E-Value: 3e-96
Query Start/End: Original strand, 10 - 200
Target Start/End: Original strand, 39524322 - 39524512
Alignment:
| Q |
10 |
gcagagacgccatttttagggttttaggagaaggaacgtgaagaaggttggaagggatggtaacaatcgttacaaaggggttttagttttggaatagact |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
39524322 |
gcagagacgccatttttagggttttaggagaaggaacgtgaagaaggttggaagggatgggaacaatcgttacaaaggagttttagttttggaatagact |
39524421 |
T |
 |
| Q |
110 |
tgcctacagtaccatacacacagttcttactgttcccctatcacagcaacaagccacgtgtattaaaattctctctcttgcgtaggtttaa |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39524422 |
tgcctacagtaccatacacacagttcttactgttcccctatcacaacaacaagccacgtgtattaaaattctctctcttgcgtaggtttaa |
39524512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 132; E-Value: 4e-68
Query Start/End: Original strand, 364 - 535
Target Start/End: Original strand, 39525846 - 39526016
Alignment:
| Q |
364 |
aagttggttccttccaaccctttctttgtgttcccttcttttaggggtggataaacggtcggtttcagtcgggggtggaccagaactgccaatccgatca |
463 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||| |||||||||||||||||||||| |
|
|
| T |
39525846 |
aagtcggttccttccaaccctttctttgtgttcccttcttttaggggtggataaacggtcggtttcggtcgacggtgaaccagaactgccaatccgatca |
39525945 |
T |
 |
| Q |
464 |
aacccacggttgcacaatcaaggcccaatctcgttcgttcatgtactcggttatcggtttggacaggtgacg |
535 |
Q |
| |
|
||||||||||||||||||||||| |||||| |||||||||||||||| |||||||||||||||| ||||||| |
|
|
| T |
39525946 |
aacccacggttgcacaatcaagg-ccaatcccgttcgttcatgtacttggttatcggtttggacgggtgacg |
39526016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 112; E-Value: 3e-56
Query Start/End: Original strand, 233 - 367
Target Start/End: Original strand, 39525679 - 39525811
Alignment:
| Q |
233 |
ggttaaaccgttataaaacctacgagaatcaaataaaattgaaaaatctatgagaaatcgggaaatgaaaagctaggagaatggttgtttacgggagttt |
332 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
39525679 |
ggttaaaccgttataaaacctacgagaatcaaataaaattgaaaaatct--gagaaatcgggaagtgaaaagctaggagaatggttgtttacgggagttt |
39525776 |
T |
 |
| Q |
333 |
tggaggatcgatgtttgtgatgattcgtctgaagt |
367 |
Q |
| |
|
|||||||| |||||||||||||||| ||||||||| |
|
|
| T |
39525777 |
tggaggattgatgtttgtgatgatttgtctgaagt |
39525811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 61; E-Value: 9e-26
Query Start/End: Original strand, 636 - 719
Target Start/End: Original strand, 39526099 - 39526180
Alignment:
| Q |
636 |
ttatgtgtttgatttagatcaaagactatatgcctcatacacaccagcaggtcgagaaataagtatgatgatagaagatgaaga |
719 |
Q |
| |
|
|||||| |||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
39526099 |
ttatgtttttgatttagatcaaagactatgt--ctcatacacaccagcaggtcgagaaataagtatgataatagaagatgaaga |
39526180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 408 - 475
Target Start/End: Complemental strand, 41415604 - 41415537
Alignment:
| Q |
408 |
gggtggataaacggtcggtttcagtcgggggtggaccagaactgccaatccgatcaaacccacggttg |
475 |
Q |
| |
|
||||||| |||||||||||||| ||||| | ||||| || |||||||||| ||||||||||||||| |
|
|
| T |
41415604 |
gggtggacaaacggtcggtttcggtcggtgacggaccgaaaatgccaatccgttcaaacccacggttg |
41415537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 35; Significance: 0.0000000003; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 369 - 403
Target Start/End: Original strand, 41215831 - 41215865
Alignment:
| Q |
369 |
ggttccttccaaccctttctttgtgttcccttctt |
403 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
41215831 |
ggttccttccaaccctttctttgtgttcccttctt |
41215865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 309 - 357
Target Start/End: Original strand, 41215713 - 41215762
Alignment:
| Q |
309 |
gagaatggttgtttacgggagttttggagga-tcgatgtttgtgatgatt |
357 |
Q |
| |
|
||||||||||| ||||||||||||||||||| | |||||||||||||||| |
|
|
| T |
41215713 |
gagaatggttgcttacgggagttttggaggatttgatgtttgtgatgatt |
41215762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 35; Significance: 0.0000000003; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 405 - 475
Target Start/End: Original strand, 4475738 - 4475808
Alignment:
| Q |
405 |
taggggtggataaacggtcggtttcagtcgggggtggaccagaactgccaatccgatcaaacccacggttg |
475 |
Q |
| |
|
|||||||||| |||||||||||||| ||||| | ||||| || |||||||||| ||||||||||||||| |
|
|
| T |
4475738 |
taggggtggacaaacggtcggtttcggtcggcgacggaccgaaaatgccaatccgttcaaacccacggttg |
4475808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 405 - 475
Target Start/End: Complemental strand, 42740999 - 42740929
Alignment:
| Q |
405 |
taggggtggataaacggtcggtttcagtcgggggtggaccagaactgccaatccgatcaaacccacggttg |
475 |
Q |
| |
|
|||||||||| |||||||||||||| ||||| ||||| || |||||||||| ||||||||||||||| |
|
|
| T |
42740999 |
taggggtggacaaacggtcggtttcggtcggcaacggaccgaaaatgccaatccgttcaaacccacggttg |
42740929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 35; Significance: 0.0000000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 405 - 475
Target Start/End: Complemental strand, 42970665 - 42970595
Alignment:
| Q |
405 |
taggggtggataaacggtcggtttcagtcgggggtggaccagaactgccaatccgatcaaacccacggttg |
475 |
Q |
| |
|
|||||||||| |||||||||||||| ||||| | ||||| || |||||||||| ||||||||||||||| |
|
|
| T |
42970665 |
taggggtggacaaacggtcggtttcggtcggcgacggaccgaaaatgccaatccgttcaaacccacggttg |
42970595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 32; Significance: 0.00000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 404 - 475
Target Start/End: Complemental strand, 33694508 - 33694437
Alignment:
| Q |
404 |
ttaggggtggataaacggtcggtttcagtcgggggtggaccagaactgccaatccgatcaaacccacggttg |
475 |
Q |
| |
|
||||||||||| |||||||||||||| ||||| ||||| || |||||||||| ||||||||||||||| |
|
|
| T |
33694508 |
ttaggggtggacaaacggtcggtttcggtcggcaacggaccgaaaatgccaatccgttcaaacccacggttg |
33694437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University