View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5666_high_1 (Length: 774)

Name: NF5666_high_1
Description: NF5666
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5666_high_1
NF5666_high_1
[»] chr8 (5 HSPs)
chr8 (10-200)||(39524322-39524512)
chr8 (364-535)||(39525846-39526016)
chr8 (233-367)||(39525679-39525811)
chr8 (636-719)||(39526099-39526180)
chr8 (408-475)||(41415537-41415604)
[»] chr7 (2 HSPs)
chr7 (369-403)||(41215831-41215865)
chr7 (309-357)||(41215713-41215762)
[»] chr3 (2 HSPs)
chr3 (405-475)||(4475738-4475808)
chr3 (405-475)||(42740929-42740999)
[»] chr2 (1 HSPs)
chr2 (405-475)||(42970595-42970665)
[»] chr5 (1 HSPs)
chr5 (404-475)||(33694437-33694508)


Alignment Details
Target: chr8 (Bit Score: 179; Significance: 3e-96; HSPs: 5)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 179; E-Value: 3e-96
Query Start/End: Original strand, 10 - 200
Target Start/End: Original strand, 39524322 - 39524512
Alignment:
10 gcagagacgccatttttagggttttaggagaaggaacgtgaagaaggttggaagggatggtaacaatcgttacaaaggggttttagttttggaatagact 109  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||    
39524322 gcagagacgccatttttagggttttaggagaaggaacgtgaagaaggttggaagggatgggaacaatcgttacaaaggagttttagttttggaatagact 39524421  T
110 tgcctacagtaccatacacacagttcttactgttcccctatcacagcaacaagccacgtgtattaaaattctctctcttgcgtaggtttaa 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||    
39524422 tgcctacagtaccatacacacagttcttactgttcccctatcacaacaacaagccacgtgtattaaaattctctctcttgcgtaggtttaa 39524512  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 132; E-Value: 4e-68
Query Start/End: Original strand, 364 - 535
Target Start/End: Original strand, 39525846 - 39526016
Alignment:
364 aagttggttccttccaaccctttctttgtgttcccttcttttaggggtggataaacggtcggtttcagtcgggggtggaccagaactgccaatccgatca 463  Q
    |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||  |||| ||||||||||||||||||||||    
39525846 aagtcggttccttccaaccctttctttgtgttcccttcttttaggggtggataaacggtcggtttcggtcgacggtgaaccagaactgccaatccgatca 39525945  T
464 aacccacggttgcacaatcaaggcccaatctcgttcgttcatgtactcggttatcggtttggacaggtgacg 535  Q
    ||||||||||||||||||||||| |||||| |||||||||||||||| |||||||||||||||| |||||||    
39525946 aacccacggttgcacaatcaagg-ccaatcccgttcgttcatgtacttggttatcggtttggacgggtgacg 39526016  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 112; E-Value: 3e-56
Query Start/End: Original strand, 233 - 367
Target Start/End: Original strand, 39525679 - 39525811
Alignment:
233 ggttaaaccgttataaaacctacgagaatcaaataaaattgaaaaatctatgagaaatcgggaaatgaaaagctaggagaatggttgtttacgggagttt 332  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||  ||||||||||||| |||||||||||||||||||||||||||||||||||    
39525679 ggttaaaccgttataaaacctacgagaatcaaataaaattgaaaaatct--gagaaatcgggaagtgaaaagctaggagaatggttgtttacgggagttt 39525776  T
333 tggaggatcgatgtttgtgatgattcgtctgaagt 367  Q
    |||||||| |||||||||||||||| |||||||||    
39525777 tggaggattgatgtttgtgatgatttgtctgaagt 39525811  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 61; E-Value: 9e-26
Query Start/End: Original strand, 636 - 719
Target Start/End: Original strand, 39526099 - 39526180
Alignment:
636 ttatgtgtttgatttagatcaaagactatatgcctcatacacaccagcaggtcgagaaataagtatgatgatagaagatgaaga 719  Q
    |||||| |||||||||||||||||||||| |  |||||||||||||||||||||||||||||||||||| ||||||||||||||    
39526099 ttatgtttttgatttagatcaaagactatgt--ctcatacacaccagcaggtcgagaaataagtatgataatagaagatgaaga 39526180  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 408 - 475
Target Start/End: Complemental strand, 41415604 - 41415537
Alignment:
408 gggtggataaacggtcggtttcagtcgggggtggaccagaactgccaatccgatcaaacccacggttg 475  Q
    ||||||| |||||||||||||| ||||| |  |||||  || |||||||||| |||||||||||||||    
41415604 gggtggacaaacggtcggtttcggtcggtgacggaccgaaaatgccaatccgttcaaacccacggttg 41415537  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 35; Significance: 0.0000000003; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 369 - 403
Target Start/End: Original strand, 41215831 - 41215865
Alignment:
369 ggttccttccaaccctttctttgtgttcccttctt 403  Q
    |||||||||||||||||||||||||||||||||||    
41215831 ggttccttccaaccctttctttgtgttcccttctt 41215865  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 309 - 357
Target Start/End: Original strand, 41215713 - 41215762
Alignment:
309 gagaatggttgtttacgggagttttggagga-tcgatgtttgtgatgatt 357  Q
    ||||||||||| ||||||||||||||||||| | ||||||||||||||||    
41215713 gagaatggttgcttacgggagttttggaggatttgatgtttgtgatgatt 41215762  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 35; Significance: 0.0000000003; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 405 - 475
Target Start/End: Original strand, 4475738 - 4475808
Alignment:
405 taggggtggataaacggtcggtttcagtcgggggtggaccagaactgccaatccgatcaaacccacggttg 475  Q
    |||||||||| |||||||||||||| ||||| |  |||||  || |||||||||| |||||||||||||||    
4475738 taggggtggacaaacggtcggtttcggtcggcgacggaccgaaaatgccaatccgttcaaacccacggttg 4475808  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 405 - 475
Target Start/End: Complemental strand, 42740999 - 42740929
Alignment:
405 taggggtggataaacggtcggtttcagtcgggggtggaccagaactgccaatccgatcaaacccacggttg 475  Q
    |||||||||| |||||||||||||| |||||    |||||  || |||||||||| |||||||||||||||    
42740999 taggggtggacaaacggtcggtttcggtcggcaacggaccgaaaatgccaatccgttcaaacccacggttg 42740929  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 35; Significance: 0.0000000003; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 405 - 475
Target Start/End: Complemental strand, 42970665 - 42970595
Alignment:
405 taggggtggataaacggtcggtttcagtcgggggtggaccagaactgccaatccgatcaaacccacggttg 475  Q
    |||||||||| |||||||||||||| ||||| |  |||||  || |||||||||| |||||||||||||||    
42970665 taggggtggacaaacggtcggtttcggtcggcgacggaccgaaaatgccaatccgttcaaacccacggttg 42970595  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 32; Significance: 0.00000002; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 404 - 475
Target Start/End: Complemental strand, 33694508 - 33694437
Alignment:
404 ttaggggtggataaacggtcggtttcagtcgggggtggaccagaactgccaatccgatcaaacccacggttg 475  Q
    ||||||||||| |||||||||||||| |||||    |||||  || |||||||||| |||||||||||||||    
33694508 ttaggggtggacaaacggtcggtttcggtcggcaacggaccgaaaatgccaatccgttcaaacccacggttg 33694437  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University