View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5666_high_16 (Length: 243)
Name: NF5666_high_16
Description: NF5666
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5666_high_16 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 52 - 235
Target Start/End: Original strand, 47706518 - 47706701
Alignment:
| Q |
52 |
gtgaaatggttataaagaaatatgatttctgaaattattataattcctggacacatggctaggcaaccttatatccctgactgttaatgttattgcttgc |
151 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47706518 |
gtgaaatggttataaagaaatatgatttctgaaattataataattcctggacacatggctaggcaaccttatatccctgactgttaatgttattgcttgc |
47706617 |
T |
 |
| Q |
152 |
agtactgtcccaatctgtcagatatccaaatttatttctctgcaccttatcacgcccacatttaactgccgcatctttatattc |
235 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
47706618 |
agtactgtcccaatctgtcagatatccaaatttatttctctgcaccttatcacgctcacatttaactgccgcatctttatattc |
47706701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University