View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5666_low_13 (Length: 325)
Name: NF5666_low_13
Description: NF5666
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5666_low_13 |
 |  |
|
| [»] scaffold0043 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr3 (Bit Score: 277; Significance: 1e-155; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 277; E-Value: 1e-155
Query Start/End: Original strand, 11 - 307
Target Start/End: Original strand, 28507428 - 28507724
Alignment:
| Q |
11 |
cacagaatcaatggaaaagataaacattgtgcctgaggtgtatctttcatgggtaacaacaggttcatcatgtcagatatgaagaaacacaagcagatca |
110 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28507428 |
cacagaatcaatggaaaagagaaacattgtgcttgaggtgtatctttcatgggtaacaacaggttcatcatgtcagatatgaagaaacacaagcagatca |
28507527 |
T |
 |
| Q |
111 |
gggaagcaaaattactctcatgttatggaaaaacacatctagatcatacttaatcaattttatacaatttcacagtcagctcatactccaaagtaatcaa |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28507528 |
gggaagcaaaattactctcatgttatggaaaaacacatctagatcatactgaatgaatgttatacaatttcacagtcagctcatactccaaagtaatcaa |
28507627 |
T |
 |
| Q |
211 |
atgtctctttttaattgagcactttttcactttcagcttaccttgaaaaatgaaattcagaaaaattgcttacaattaaatttccacctttacttat |
307 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28507628 |
atgtctctttttaattgagcactttttcactttcagcttaccttgaaaaatgaaattcagaaaaattgcttacaattaaatttccacctttacttat |
28507724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0043 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: scaffold0043
Description:
Target: scaffold0043; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 102 - 201
Target Start/End: Original strand, 49828 - 49927
Alignment:
| Q |
102 |
agcagatcagggaagcaaaattactctcatgttatggaaaaacacatctagatcatacttaatcaattttatacaatttcacagtcagctcatactccaa |
201 |
Q |
| |
|
||||||||| ||||||||||| |||||||||||| || || ||| |||| ||||||| ||| | ||| ||||||||||||| || ||||||||||| |
|
|
| T |
49828 |
agcagatcaaggaagcaaaatggatctcatgttatgaaagaatacagctagctcatactaaataagtttattacaatttcacaggcatttcatactccaa |
49927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University