View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5667_low_5 (Length: 257)
Name: NF5667_low_5
Description: NF5667
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5667_low_5 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 9 - 239
Target Start/End: Original strand, 38419316 - 38419546
Alignment:
| Q |
9 |
ttataatttgcaatagaatgcatctcttatatacacaatgcaaaacttaacaaacttcctaagaaatttcaacaaaattaaccaaagaaaacagataact |
108 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38419316 |
ttataatttgcaatacaatgcatctcttatatacacaatgcaaaacttaacaaacttcctaagaaatttcaacaaaattaaccaaagaaaacagataact |
38419415 |
T |
 |
| Q |
109 |
tgtgatgcaagtaatcatcaactaagatgaattattttgaaattaattaggtttttgagacaaagtacgccattgtctctcaaatactcagatacggtga |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38419416 |
tgtgatgcaagtaatcatcaactaagatgaattattttgaaattaattaggtttttgagacaaagtacgccattgtctctcaaatactcagatacggtga |
38419515 |
T |
 |
| Q |
209 |
agtatgcctgatgcaaggcgatcaagtgcct |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
38419516 |
agtatgcctgatgcaaggcgatcaagtgcct |
38419546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University