View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5667_low_7 (Length: 246)
Name: NF5667_low_7
Description: NF5667
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5667_low_7 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 164; Significance: 9e-88; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 164; E-Value: 9e-88
Query Start/End: Original strand, 1 - 244
Target Start/End: Original strand, 38419089 - 38419319
Alignment:
| Q |
1 |
ttattagaagttcaccaaagaaaattcaactagcaatagtatagatgactggggttatttacnnnnnnnnnnnnnnnnnatggatcagcttctaatttgt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
38419089 |
ttattagaagttcaccaaagaaaattcaactagcaatagtatagatggctggggttatttacttttt------------atggatcagcttctaatttgt |
38419176 |
T |
|
| Q |
101 |
gatgaatctcaagtgaaattatgagaagagaaatgccagcaataaacatttcagcatacacttttcaacacaatctctaaaaactagtgaaagagagaaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38419177 |
gatgaatctcaagtgaaattatgagaagagaaatgccagcaacaaacatttcaccatacatttttcaacacaatctctaaaaactagtgaaagagagaaa |
38419276 |
T |
|
| Q |
201 |
attgattaagagggaaaagatgttattggaagttttgtatttat |
244 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
38419277 |
attgattaaga-ggaaaagatgttattggaagttttgtatttat |
38419319 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University