View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5668_high_16 (Length: 253)
Name: NF5668_high_16
Description: NF5668
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5668_high_16 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 16 - 253
Target Start/End: Complemental strand, 33819344 - 33819110
Alignment:
| Q |
16 |
tgaaatggatgcgagattagcatgcaacgtgacgtgttcagttaatatgtcatatcataacttctaaattctaacgaggacaacttttgattaatatttt |
115 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||| ||| |||| |
|
|
| T |
33819344 |
tgaaatggatgcgagattagcatgcaacgagacgtgttcagttaatatgtcatatcataacttctaagttctaacgaggataacttttgatcaatgtttt |
33819245 |
T |
|
| Q |
116 |
acgttttcaaatatatcttttataatatttttgaatgatatcttacaatttcaaaaaatgtgtatcttaatttgcaaaaataagagactatttcgacaaa |
215 |
Q |
| |
|
|||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||| |
|
|
| T |
33819244 |
acgttttcaaatatgtcttttataat---tttgaatgatatcttacaatttcaaaaaatgtgtatcttaatttgcaataataagatactatttcgacaaa |
33819148 |
T |
|
| Q |
216 |
tatttacaatttagaggatcgattttccccactctatt |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33819147 |
tatttacaatttagaggatcgattttccccactctatt |
33819110 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University