View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5668_high_18 (Length: 238)
Name: NF5668_high_18
Description: NF5668
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5668_high_18 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 1 - 238
Target Start/End: Complemental strand, 36965436 - 36965189
Alignment:
| Q |
1 |
caagcaagtatacacacgtcgttaaaaaatattgcgtttttaccttgtagaatgtgaggtggtaaagac-------acaacataacaaaggaaaatgtcg |
93 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
36965436 |
caagcaagtatacacacggcgttaaaaaatatggcgtttttaccttgtagaatgtgaggtggtaaagactaaagacacaacataacaaaggaaaatgtcg |
36965337 |
T |
|
| Q |
94 |
ggtaaatggggagaaaatggtatttgacagaagatatgtgttgcattgcattagatcaaaagatttggtctagttaggcaatt---atgagaggtaaaga |
190 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
36965336 |
ggtaaatggggagaaaatggtatttgacagaagatatgggttgcattgcattagatcaaaagatttggtctagttaggcaattatgatgagaggtaaaga |
36965237 |
T |
|
| Q |
191 |
atgaaggaagacatgatttagtttagttgtttcctttgatgacatatt |
238 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36965236 |
aagaaggaagacatgatttagtttagttgtttcctttgatgacatatt |
36965189 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University