View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5668_low_14 (Length: 275)
Name: NF5668_low_14
Description: NF5668
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5668_low_14 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 159; Significance: 1e-84; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 159; E-Value: 1e-84
Query Start/End: Original strand, 99 - 257
Target Start/End: Original strand, 4158872 - 4159030
Alignment:
| Q |
99 |
tgcacttcatgataacaagccaattttggctttgtgttttggtcttgtacgtgccataccagctttcaaagcaaccctttaatttctcatccacaatatt |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4158872 |
tgcacttcatgataacaagccaattttggctttgtgttttggtcttgtacgtgccataccagctttcaaagcaaccctttaatttctcatccacaatatt |
4158971 |
T |
 |
| Q |
199 |
cttctctcttacccttcacacactcacaaacaaatcctgaaatttccacactaagcagg |
257 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4158972 |
cttctctcttacccttcacacactcacaaacaaatcctgaaatttccacactaagcagg |
4159030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 13 - 60
Target Start/End: Original strand, 4158786 - 4158833
Alignment:
| Q |
13 |
tgagatacatgcatatcataatgctataatgtagtgcaattattgagc |
60 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4158786 |
tgagacacatgcatatcataatgctataatgtagtgcaattattgagc |
4158833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University