View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5668_low_15 (Length: 262)
Name: NF5668_low_15
Description: NF5668
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5668_low_15 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 129; Significance: 7e-67; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 129; E-Value: 7e-67
Query Start/End: Original strand, 1 - 177
Target Start/End: Original strand, 21722580 - 21722755
Alignment:
| Q |
1 |
aacatgtttgaatttcatctctctaaggtcaaaagtcaaaacaattctttttgctcactgcattcactttataacaaa-aaataagactt-agagttaaa |
98 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||| | ||||||||| ||||||||| |
|
|
| T |
21722580 |
aacatgtttgaatttcatctctctagggtcaaaagtcaaaacaattccttttgctcactgcattcactttataacaaatagataagacttaagagttaaa |
21722679 |
T |
|
| Q |
99 |
ttaatttttcattcataaaaatatagtaaactcttattttggtgcttaaaaaataataaaatgtggtgttttcacactc |
177 |
Q |
| |
|
| |||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
21722680 |
taaatttttcatccataaaaatatagtaaactcttattttggtgcttaaaa---aataaaatgtggtgttttcacactc |
21722755 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 201 - 253
Target Start/End: Original strand, 21722780 - 21722832
Alignment:
| Q |
201 |
atccctaatggatataattttaacatgtttctaatatttcttgaacattttat |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||| |||| |
|
|
| T |
21722780 |
atccctaatggatataattttaacatgtttcttatatttcttgaacatattat |
21722832 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University