View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5668_low_18 (Length: 251)
Name: NF5668_low_18
Description: NF5668
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5668_low_18 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 11 - 229
Target Start/End: Original strand, 4158484 - 4158702
Alignment:
| Q |
11 |
cagagaggagggaaaaagcagttttgctttttagtttttatggcttttacccaagatatgttaaaagttatttcataatcagcccctcatcatctctcat |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4158484 |
cagagaggagggaaaaagcagttttgctttttagtttttatggcttttacccaagatatgttaaaagttatttcataatcagcccctcatcatctctcat |
4158583 |
T |
 |
| Q |
111 |
ggaccataccataatattataactttatctctactttttatggaggagaatgtttgcttcaataatcaatcaatatgccagatattttactatttaacaa |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4158584 |
ggaccataccataatattataactttatctctactttttatggaggagaatgtttgcttcaataatcaatcaatatgccagatattttactatttaacaa |
4158683 |
T |
 |
| Q |
211 |
tattgctttattatccttc |
229 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
4158684 |
tattgctttattatccttc |
4158702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University