View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5669_high_3 (Length: 224)

Name: NF5669_high_3
Description: NF5669
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5669_high_3
NF5669_high_3
[»] chr1 (1 HSPs)
chr1 (16-208)||(42743958-42744147)


Alignment Details
Target: chr1 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 16 - 208
Target Start/End: Complemental strand, 42744147 - 42743958
Alignment:
16 aggaggaagatcgtagcagaaatggggacaatgaccgagctcaagcaacaacggaaatggcttacacagcaaatagaagggtggcagcagctgggttgca 115  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||| |||||||||||||||||||| |||||    
42744147 aggaggaagatcgtagcagaaatggggacaatgaccgagctcaagcaacaacggaaatgacttagacagcaaagagaagggtggcagcagctggattgca 42744048  T
116 cttcattttattc-tagaatgcatcaccaaagtgttctttaattactaggaaaatccacatatatatctttgataattaacattgaatcaaact 208  Q
    ||| ||||| ||| |||||||||||| |||||||||||    |||||||||||| |||||||||||||||||||||||||||||||||||||||    
42744047 ctttatttttttcatagaatgcatcatcaaagtgttct----ttactaggaaaagccacatatatatctttgataattaacattgaatcaaact 42743958  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University