View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5669_low_2 (Length: 299)
Name: NF5669_low_2
Description: NF5669
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5669_low_2 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 10 - 299
Target Start/End: Complemental strand, 47193547 - 47193249
Alignment:
| Q |
10 |
aagaatatcacttaaacaatcttgataaccaaaaataacatggttgcaatgttttcaaattgagcacatgcaagccaaccaaatcgattgaagacaatcc |
109 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
47193547 |
aagaatatcacttaaacaatcttgataacaaaaaataacatggttgcaatgttttcaaattgagcacatgcaagccaaccaaatcgaatgaagacaatcc |
47193448 |
T |
 |
| Q |
110 |
ttcacttttttcctttgtgacacctaacctttaaattgaaccacatgacaaagtttttgtcaagacacaactgattcctaaccaagatgatacatctaac |
209 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
47193447 |
ttcacttttttcccttgtgacacctaacctttaaattgaaccacatgacaaagtttttgtcaagacacaactaattcctaaccaagatgatacatctaac |
47193348 |
T |
 |
| Q |
210 |
cataatttacgaaaaataggacattcaaaaaacaaataattggagg---------tatcacatctttccgcacataaaggtgatgttaaattatgtacc |
299 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||| ||||||||||||| |
|
|
| T |
47193347 |
cataatttacgagaaataggacattcaaaaaacaaataattggaggtttcattcatatcacatctttccgcgcataaaggtgatgctaaattatgtacc |
47193249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University