View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5669_low_3 (Length: 224)
Name: NF5669_low_3
Description: NF5669
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5669_low_3 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 16 - 208
Target Start/End: Complemental strand, 42744147 - 42743958
Alignment:
| Q |
16 |
aggaggaagatcgtagcagaaatggggacaatgaccgagctcaagcaacaacggaaatggcttacacagcaaatagaagggtggcagcagctgggttgca |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||| |||||||||||||||||||| ||||| |
|
|
| T |
42744147 |
aggaggaagatcgtagcagaaatggggacaatgaccgagctcaagcaacaacggaaatgacttagacagcaaagagaagggtggcagcagctggattgca |
42744048 |
T |
|
| Q |
116 |
cttcattttattc-tagaatgcatcaccaaagtgttctttaattactaggaaaatccacatatatatctttgataattaacattgaatcaaact |
208 |
Q |
| |
|
||| ||||| ||| |||||||||||| ||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42744047 |
ctttatttttttcatagaatgcatcatcaaagtgttct----ttactaggaaaagccacatatatatctttgataattaacattgaatcaaact |
42743958 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University