View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5670-Insertion-11 (Length: 179)
Name: NF5670-Insertion-11
Description: NF5670
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5670-Insertion-11 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 142; Significance: 9e-75; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 142; E-Value: 9e-75
Query Start/End: Original strand, 8 - 179
Target Start/End: Original strand, 47493817 - 47493985
Alignment:
| Q |
8 |
ttttgatcatctgttccagttcttcgtctgtcaccttttctccgatggtactcaatactgacctcaactgggctcacacgtaatatcaattatatagtcc |
107 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
47493817 |
ttttgatcatctgctccagttcttcgtctgtcaccttttctccgatggtactcaatactgacctcaactgggctcacacgtaatatcaattatatagttc |
47493916 |
T |
 |
| Q |
108 |
aatattacggtacgacaaaacaaattatatatgttgaattaattacacctcactgggtgatatgtaaccatc |
179 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
47493917 |
---attacggtacaacaaaacaaattatatatgttgaattaattatacctcactgggtgatatgtaaccatc |
47493985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University