View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5670-Insertion-9 (Length: 222)
Name: NF5670-Insertion-9
Description: NF5670
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5670-Insertion-9 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 21 - 222
Target Start/End: Original strand, 22329618 - 22329819
Alignment:
| Q |
21 |
catgcagattaaataactgagctagcttgctcaaaagttgttgtttatttccatcttggtgtaaaaccccagttgcagaatgaagcattttctccttgtc |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22329618 |
catgcagattaaataactgagctagcttgctcaaaagttgttgtttatttccatcttggtgtaaaaccccagttgcagaatgaagcattttctccttgtc |
22329717 |
T |
|
| Q |
121 |
acgaaaaaggtagtaaacccaaataacccgacatataaattttgcatattcaaacttgtgtatgattttggctttggttgttggtataaatggttaatgc |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
22329718 |
acgaaaaaggtagtaaacccaaataacccgacatataaattttgcatattcaaacttgtgtatgattttggctttggttgttggtatatatggttaatgc |
22329817 |
T |
|
| Q |
221 |
tg |
222 |
Q |
| |
|
|| |
|
|
| T |
22329818 |
tg |
22329819 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University