View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5670_high_5 (Length: 361)
Name: NF5670_high_5
Description: NF5670
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5670_high_5 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 304; Significance: 1e-171; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 304; E-Value: 1e-171
Query Start/End: Original strand, 9 - 344
Target Start/End: Complemental strand, 38256195 - 38255860
Alignment:
| Q |
9 |
attattctgcaacttccttttctgtctctgatccagtggaattttccctccttttctgtgtatgcagttcgatatatgctgtaaggaagattaacatgcc |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38256195 |
attattctgcaacttccttttctgtctctgatccagtggaattttccctccttttctgtgtatgcagttcgatatatgctgtaaggaagattaacatgcc |
38256096 |
T |
 |
| Q |
109 |
agttcatcccgatatcctttggtctggattttaatggggagcttaacgaagagttttcatgtccaatgcgatcaatcatctcaatgttgtnnnnnnnnga |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||| || |
|
|
| T |
38256095 |
agttcatcccgatatcctttggtctggattttaatggggagcttaacgaagagttttcatgtccaatgtgatccatcatctcaatgttgtaaaaaaaaga |
38255996 |
T |
 |
| Q |
209 |
atcaacacatgggaagaaagtagaaggaagtcaagcacaggtgcatatccgtgtggacttgggaactggtgggggaaaatagtatttatgatagtttttg |
308 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38255995 |
atcaacacatgggaagaaagtagaaggaagtcaagcacaggtgcatatccgtgtggacttgggaactggtgggggaaaatagtatttatgatagtttttg |
38255896 |
T |
 |
| Q |
309 |
cttcttcttttattaaattaaataaactgtgctatc |
344 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
38255895 |
cttcttcttttattaaattaaataaactgtgctatc |
38255860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University