View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5670_low_5 (Length: 375)
Name: NF5670_low_5
Description: NF5670
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5670_low_5 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 283; Significance: 1e-158; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 283; E-Value: 1e-158
Query Start/End: Original strand, 13 - 356
Target Start/End: Complemental strand, 9866784 - 9866438
Alignment:
| Q |
13 |
aatataaatggtgaggtagtgatatcaaaggttgagaattgccatgaagaaagaatgcgaaatacagaaggtagtgaaagagcttgcaattgtggcactg |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9866784 |
aatataaatggtgaggtagtgatatcaaaggttgagaattgccatgaagaaagaatgcgaaatacagaaggtagtgaaagagcttgcaattgtggcactg |
9866685 |
T |
 |
| Q |
113 |
gtcttcttcaacgtatatatcttcatcttagtactcttcttcctaccatttcagtatctgaggttagtaatc----cctatctatccgtctatctatctg |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||| |||| |||||||| |
|
|
| T |
9866684 |
gtcttcttcaacgtatatatcttcatcttagtactcttcttcctaccatttcagtatccgaggttagtaatctctatctatctatctgtctgtctatctg |
9866585 |
T |
 |
| Q |
209 |
tctgtctgtccgtgtttttgttatgtggactaagcaaagtttttctcatgttttctaaacttgtttgctgggtttaaagaacattttgaaaacctaacat |
308 |
Q |
| |
|
||||||||| ||||||||||||||||||||| |||||| |||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
9866584 |
tctgtctgttcgtgtttttgttatgtggactgagcaaattttttctcatgttttctaaacttgtttgttgggttt-aagaacattttgaaaacctaacat |
9866486 |
T |
 |
| Q |
309 |
gatatcatataatgaactaacttattttgttgacacatacacatataa |
356 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
9866485 |
aatatcatataatgaactaactttttttgttgacacatacacatataa |
9866438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University