View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5670_low_9 (Length: 251)
Name: NF5670_low_9
Description: NF5670
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5670_low_9 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 17 - 251
Target Start/End: Original strand, 46121388 - 46121622
Alignment:
| Q |
17 |
tctaaaaggcttgctcatcttctctatttgagcattgtgaagaaatctcacaatgacacatttttgttggatttgttggtgaatggtcagcttaatctga |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46121388 |
tctaaaaggcttgctcatcttctctatttgagcattgtgaagaaatctcacaatgacacatttttgttggatttgttggtgaatggtcagcttaatctga |
46121487 |
T |
 |
| Q |
117 |
ttttcagataaaatacatcacaataatacatagttgcttgtaaaatatactgttcatagaataaaatatattgttgcaaagnnnnnnntattgatcgata |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
46121488 |
ttttcagataaaatacatcacaataatacatagttgcttgtaaaatatactgttcatagaataaaatatattgttgcaaagaaaaaaatattgatcgata |
46121587 |
T |
 |
| Q |
217 |
tttttgtatcaaatgaatattctatagaatttatt |
251 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
46121588 |
tttttgtatcaaatgaatattctatagaatttatt |
46121622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University