View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5671_low_1 (Length: 293)
Name: NF5671_low_1
Description: NF5671
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5671_low_1 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 247; Significance: 1e-137; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 1 - 275
Target Start/End: Original strand, 19988755 - 19989029
Alignment:
| Q |
1 |
ggtgagggaaacaaggtgatgagtatcaccttttcttgttggaggatgatgcacaagaggcattgggagagacatagcttttgaaacttgtgaagaatta |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19988755 |
ggtgagggaaacaaggtgatgagtatcaccttttcttgttggagggtgatgcacaagaggcattgggagagacatagcttttgaaacttgtgaagaatta |
19988854 |
T |
|
| Q |
101 |
gaatggtggtcctcggaatttttgacaactatggtaaggttttttgagaccggacaacccatgaatgaatgtgttcaaattgaagaaattggtggaattt |
200 |
Q |
| |
|
||||||| ||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19988855 |
gaatggttgtcctcggaatttttaacaactatggtaaggttttttgagactggacaacccatgaatgaatgtgttcaaattgaagaaattggtggaattt |
19988954 |
T |
|
| Q |
201 |
gtctgcgtatgtggttgtcttgttgggaagacataaaagaagaaatcgagtagtgtcgggtgaaagtgatgtttc |
275 |
Q |
| |
|
|| || |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19988955 |
gtgtgtgtatgtggttgtcttgttaggaagacataaaagaagaaatcgagtagtgtcgggtgaaagtgatgtttc |
19989029 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 37; Significance: 0.000000000007; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 2 - 82
Target Start/End: Original strand, 35420821 - 35420901
Alignment:
| Q |
2 |
gtgagggaaacaaggtgatgagtatcaccttttcttgttggaggatgatgcacaagaggcattgggagagacatagctttt |
82 |
Q |
| |
|
||||| ||||||||||||||||| ||||||||| | |||||||| ||||| | ||||||||||| || |||| ||||||| |
|
|
| T |
35420821 |
gtgagtgaaacaaggtgatgagtgtcaccttttttggttggagggtgatggataagaggcattgtaagggacaaagctttt |
35420901 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University