View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5672-Insertion-6 (Length: 225)
Name: NF5672-Insertion-6
Description: NF5672
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5672-Insertion-6 |
 | |
|
| [»] chr5 (2 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 72; Significance: 7e-33; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 85 - 225
Target Start/End: Original strand, 38051672 - 38051827
Alignment:
| Q |
85 |
cttatcatgaagaaagaactgacattgtgttgtaacaataccgaaaacaacaagatgacacgctgctatat-at-gtgataggcatcaatatgattcaat |
182 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||| | |||||||||| | || |||||||||||||||||||||||| |
|
|
| T |
38051672 |
cttatcatgaagaaagaactgaccttgtgttgtaacaataccgaaaacaacaagatcagacgctgctatgtgatactgataggcatcaatatgattcaat |
38051771 |
T |
|
| Q |
183 |
gtgtg-------------gcagctaccttctcatccaaactctttacactctactt |
225 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
38051772 |
gtgtgctgcttctatgttgcagctaccttctcatccaaactctttaccctctactt |
38051827 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 8 - 88
Target Start/End: Original strand, 38051445 - 38051523
Alignment:
| Q |
8 |
tatttgagaagcgtgaaaaagcaactaaattaaggcaccattcatagtattgatttaattcccttggctattcattactta |
88 |
Q |
| |
|
|||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||| |
|
|
| T |
38051445 |
tatttgagaagcgtgacattgcaactaaattaaggcaccattcatagtattgatttaattccctt--caattcattactta |
38051523 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University