View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5672_high_11 (Length: 303)
Name: NF5672_high_11
Description: NF5672
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5672_high_11 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 251; Significance: 1e-139; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 2 - 293
Target Start/End: Complemental strand, 6400735 - 6400440
Alignment:
| Q |
2 |
tgatcccagtcacatgtatgcagtactgatatgccttgcctttgttttgtgcactttat----gcaagtccaattgagtctgttatgtcccttttacttt |
97 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
6400735 |
tgatcccagtcacatgtatgcaatactgatatgccttgccagtgttttgtgcactttatatatgcaagtccaattgagcctgttatgtcccttttacttt |
6400636 |
T |
 |
| Q |
98 |
tgacagataacgggcttttgtttctttgaatagctcgatatttcattatattgtatggagcaggttcaaactataatttagttcatttagtgtttgacca |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6400635 |
tgacagataacgggcttttgtttctttgaatagctcgatattacattatattgtatggagcaggttcaaactataatttagttcatttagtgtttgacca |
6400536 |
T |
 |
| Q |
198 |
tgattgtgagggattaagggatggtgaggtctacgatgttcaaacctttggcaatactgcagatgatccgtttgcatataaaacttatttcctatg |
293 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
6400535 |
tgattgtgagggattaagggatggtgaggtctacggtgttcaaacctttggcaatactgcagatgatccgtgtgcatataaaacttatttcctatg |
6400440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University