View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5672_high_17 (Length: 262)
Name: NF5672_high_17
Description: NF5672
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5672_high_17 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 217; Significance: 1e-119; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 9 - 245
Target Start/End: Original strand, 47339307 - 47339543
Alignment:
| Q |
9 |
gagatgaaggagcacgtgctatagctgaggttgtgaagtgttcttcttgcttggaggattttcgttgttcctccacaaggataggcgatgaaggtggcgt |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
47339307 |
gagatgaaggagcacgtgctatagctgaggttgtgaagcgttcttcttgcttggaggattttcgttgttcctccacaaggataggcgatgaaggtggagt |
47339406 |
T |
 |
| Q |
109 |
tgccttatctgatgctttggggaattgcacccatttgaggaagcttgatttgcgagacaacatgttaggtgtagagggtggggtttctctgagtaaagct |
208 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
47339407 |
tgccttatctgatgctttgggggattgcacccatttgaggaagcttgatttgcgagacaacatgttaggtgtagagggtggggtttccctgagtaaagct |
47339506 |
T |
 |
| Q |
209 |
cttgccaagaatgcagagttaaaagagatatacctga |
245 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||| |
|
|
| T |
47339507 |
cttgccaagaatgcagagttaagagagatatacctga |
47339543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 133 - 206
Target Start/End: Original strand, 32061944 - 32062017
Alignment:
| Q |
133 |
ttgcacccatttgaggaagcttgatttgcgagacaacatgttaggtgtagagggtggggtttctctgagtaaag |
206 |
Q |
| |
|
|||||| ||||||| ||||||||||||||| ||||||||||| ||||| || | ||| ||| |||| ||||||| |
|
|
| T |
32061944 |
ttgcacgcatttgaagaagcttgatttgcgtgacaacatgtttggtgtggaagctggagttgctctaagtaaag |
32062017 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University