View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5672_high_5 (Length: 410)
Name: NF5672_high_5
Description: NF5672
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5672_high_5 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 377; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 377; E-Value: 0
Query Start/End: Original strand, 16 - 404
Target Start/End: Complemental strand, 27763449 - 27763061
Alignment:
| Q |
16 |
caaactcttggttttcttctcctctttttcctttgcaccacttgaggattattcattgtttcttcttgttccatagattgtctttttctactattcatca |
115 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27763449 |
caaactcttggttttctcctcctctttttcctttgcaccacttgaggattattcattgtttcttcttgttccatagattgtctttttctactattcatca |
27763350 |
T |
 |
| Q |
116 |
tagaacagttactttgatcaaatattgcagcatctgcttcatgatgtgcttgttcatgatcatagttcattgtattttccaagaaactagactcatttgt |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27763349 |
tagaacagttactttgatcaaatattgcagcatctgcttcatgatgtgcttgttcatgatcatagttcattgtattttccaagaaactagactcatttgt |
27763250 |
T |
 |
| Q |
216 |
agtatcaattaggttactactaaatgaagttgcagaaattgtgtcatagataatgaagtttgaatttgaaaactcattgcatgatgatgaaagagtttcc |
315 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27763249 |
agtatcaataaggttactactaaatgaagttgcagaaattgtgtcatagataatgaagtttgaatttgaaaactcattgcatgatgatgaaagagtttcc |
27763150 |
T |
 |
| Q |
316 |
aaagccattgtattatcacaagaattttcaatcttcatgtcttcatttatagcaaaatatcactgtattatatataagagctgatgatg |
404 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
27763149 |
aaagccattgtattatcacaagaattttcaatcttcatgtcttcatttatagcaaaatatcactgtattatatataagagttgatgatg |
27763061 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 44; Significance: 6e-16; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 293 - 404
Target Start/End: Complemental strand, 13788767 - 13788657
Alignment:
| Q |
293 |
tgcatgatgatgaaagagtttccaaagccattgtattatcacaagaattttcaatcttcatgtcttcatttatagcaaaatatcactgtattatatataa |
392 |
Q |
| |
|
||||| ||||||||||||||| ||||| |||||||| | || ||| ||| |||||||||||| |||| |||||||||||||||| |||| ||||||| |
|
|
| T |
13788767 |
tgcattatgatgaaagagtttacaaaggcattgtatcactgcattaatcttcgatcttcatgtct-cattgatagcaaaatatcactatattttatataa |
13788669 |
T |
 |
| Q |
393 |
gagctgatgatg |
404 |
Q |
| |
|
||| |||||||| |
|
|
| T |
13788668 |
gagttgatgatg |
13788657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University