View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5672_low_11 (Length: 342)
Name: NF5672_low_11
Description: NF5672
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5672_low_11 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 206; Significance: 1e-112; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 206; E-Value: 1e-112
Query Start/End: Original strand, 1 - 218
Target Start/End: Complemental strand, 3482253 - 3482036
Alignment:
| Q |
1 |
aatacagcataatttagcatttggtgtcagctgaagaaggtactatgttatatagtttcaatttctttgtatgttcactttggttggtatgcaatttctg |
100 |
Q |
| |
|
||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
3482253 |
aatacagcagaatttagcatttggtggcagctgaagaaggtactatgttatatagtttcaatttctttgtatgttcactttggttggtatgcaattcctg |
3482154 |
T |
|
| Q |
101 |
ctaccataaatagcttcaaaagtggagtttccattaataaacaactagtatacatataataatcttaatgcacatgcttgcttacatttttgtcatattt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3482153 |
ctaccataaatagcttcaaaagtggagtttccattaataaacaactagtatacatataataatcttaatgcacatgcttgcttacatttttgtcatattt |
3482054 |
T |
|
| Q |
201 |
gacctcttaatgcacatg |
218 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
3482053 |
gacctcttaatgcacatg |
3482036 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 259 - 319
Target Start/End: Complemental strand, 3481997 - 3481933
Alignment:
| Q |
259 |
atgcatgcatatgctgtcttctctctgtctctct----actgtctttctcctttgtagtacttgt |
319 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||| |
|
|
| T |
3481997 |
atgcatgcatatgctgtcttctctctctctctctctctactgtctttctcctttgtagtacttgt |
3481933 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University