View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5672_low_17 (Length: 262)
Name: NF5672_low_17
Description: NF5672
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5672_low_17 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 136; Significance: 5e-71; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 136; E-Value: 5e-71
Query Start/End: Original strand, 17 - 248
Target Start/End: Complemental strand, 6400934 - 6400696
Alignment:
| Q |
17 |
aagaagattatgttgaacttatgaatacatgacatgtagtgcatgtttagttagttagtatttta---tcttgaattgttgtctaactaaagaagg---- |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||| |
|
|
| T |
6400934 |
aagaagattatgttgaacttatgaatacatgacatgtagtgcatgtttagttagttcgtattttatcttcttgaattgttgtctaactaaagaaggtttt |
6400835 |
T |
|
| Q |
110 |
-nnnnnnnnnngtgcatgcatgtgtagttgaaaggtctaggattttttcgtttcatggctcaccttctaatcnnnnnnnnnagcatatgccatatatgtt |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
6400834 |
tttttttttttgtgcatgcatgtgtagttgaaaggtctaggattttttcgtttcatggctcaccttctaatc-ttgtttttagcatatgccatatatgta |
6400736 |
T |
|
| Q |
209 |
tgatcccagtcacatgtatgcaatactgatatgccttgcc |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6400735 |
tgatcccagtcacatgtatgcaatactgatatgccttgcc |
6400696 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University