View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5672_low_25 (Length: 215)
Name: NF5672_low_25
Description: NF5672
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5672_low_25 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 103; Significance: 2e-51; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 43 - 202
Target Start/End: Original strand, 21722439 - 21722600
Alignment:
| Q |
43 |
ttaagttaaatacacccttgatatttattcttttgaaaaagcagttcttgatattgataaaataga--gtttgttttgtttctgtaattttcgaaagaaa |
140 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||| ||||||||||| ||||||||||||||||| | |
|
|
| T |
21722439 |
ttaagttaaatacacccttgatatttattcttttgaaaaagcacttctttatattgataaaatagaatttttgttttgttcctgtaattttcgaaagaga |
21722538 |
T |
 |
| Q |
141 |
nnnnnnnncatcctaagttgtgatttgattgtttatgataaaacatgtttgaatttcatctc |
202 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21722539 |
aaaaaattcatcctaagttctgatttgattgtttatgataaaacatgtttgaatttcatctc |
21722600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 18 - 46
Target Start/End: Original strand, 21722390 - 21722418
Alignment:
| Q |
18 |
atatgtgtggcttataaaaataattttaa |
46 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
21722390 |
atatgtgtggcttataaaaataattttaa |
21722418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University