View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5673-Insertion-4 (Length: 170)
Name: NF5673-Insertion-4
Description: NF5673
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5673-Insertion-4 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 119; Significance: 4e-61; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 119; E-Value: 4e-61
Query Start/End: Original strand, 32 - 170
Target Start/End: Original strand, 33129417 - 33129554
Alignment:
| Q |
32 |
tgattatagataagaatgagcgaacctagatttctttttaggcgaaacagcttagaatttaatttacacttgctataatttaacaaagtgtcattcaaaa |
131 |
Q |
| |
|
||||||||||||||||||||||||||||||||| || ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33129417 |
tgattatagataagaatgagcgaacctagattt-ttcttatccgaaacagcttagaatttaatttacacttgctataatttaacaaagtgtcattcaaaa |
33129515 |
T |
|
| Q |
132 |
taaatattgctgcttctcacggttagcatacattctacc |
170 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33129516 |
taaatattgctgcttctcacggttagcatacattctacc |
33129554 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University