View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5673_high_10 (Length: 239)
Name: NF5673_high_10
Description: NF5673
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5673_high_10 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 13 - 224
Target Start/End: Original strand, 8883442 - 8883653
Alignment:
| Q |
13 |
attctaagaacggtagggttaaaaccnnnnnnnnnttgatcaagtaggaggttaaaatttatcttaatttatgtataattttgaggtaatagtaactttt |
112 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8883442 |
attctaagaacggtagggttaaaaccaaaaaaaaattgatcaagtaggaggttaaaatttatcttaatttatgtataattttgaggtaatagtaactttt |
8883541 |
T |
 |
| Q |
113 |
aaaatctaggaaatgaaaaattgttcaatggttttactatgtacctgtagatgccttcactcttggggcatgagcagtttaggatgttttcctttgtctt |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
8883542 |
aaaatctaggaaatgaaaaattgttcaatggttttactatgtacctgtagatgccttcactcttggggcatgagcagtttaggatgttttcttttgtctt |
8883641 |
T |
 |
| Q |
213 |
gtactatatact |
224 |
Q |
| |
|
|||||||||||| |
|
|
| T |
8883642 |
gtactatatact |
8883653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University