View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5673_high_6 (Length: 290)
Name: NF5673_high_6
Description: NF5673
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5673_high_6 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 42; Significance: 0.000000000000007; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 172 - 221
Target Start/End: Original strand, 29428316 - 29428365
Alignment:
| Q |
172 |
tatcccttactctttaatcttattaggtttgaaacaattaaacctagaaa |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||| |||||||||||| |
|
|
| T |
29428316 |
tatcccttactctttaatcttattaggtttgcaacaactaaacctagaaa |
29428365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 173 - 217
Target Start/End: Complemental strand, 49632685 - 49632641
Alignment:
| Q |
173 |
atcccttactctttaatcttattaggtttgaaacaattaaaccta |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||| |||||||| |
|
|
| T |
49632685 |
atcccttactctttaatcttattaggtttgcaacaactaaaccta |
49632641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 42; Significance: 0.000000000000007; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 172 - 221
Target Start/End: Complemental strand, 49960858 - 49960809
Alignment:
| Q |
172 |
tatcccttactctttaatcttattaggtttgaaacaattaaacctagaaa |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||| |||||||||||| |
|
|
| T |
49960858 |
tatcccttactctttaatcttattaggtttgcaacaactaaacctagaaa |
49960809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 173 - 217
Target Start/End: Original strand, 35719577 - 35719621
Alignment:
| Q |
173 |
atcccttactctttaatcttattaggtttgaaacaattaaaccta |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
35719577 |
atcccttactctttaatcttattaggtttgcaacaattaaaccta |
35719621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 172 - 221
Target Start/End: Original strand, 50378361 - 50378410
Alignment:
| Q |
172 |
tatcccttactctttaatcttattaggtttgaaacaattaaacctagaaa |
221 |
Q |
| |
|
|||| |||||||||||||||||||||||||| ||||| |||||||||||| |
|
|
| T |
50378361 |
tatctcttactctttaatcttattaggtttgcaacaactaaacctagaaa |
50378410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 38; Significance: 0.000000000002; HSPs: 4)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 172 - 217
Target Start/End: Complemental strand, 41253125 - 41253080
Alignment:
| Q |
172 |
tatcccttactctttaatcttattaggtttgaaacaattaaaccta |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||| |||||||| |
|
|
| T |
41253125 |
tatcccttactctttaatcttattaggtttgcaacaactaaaccta |
41253080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 178 - 221
Target Start/End: Complemental strand, 41252864 - 41252821
Alignment:
| Q |
178 |
ttactctttaatcttattaggtttgaaacaattaaacctagaaa |
221 |
Q |
| |
|
||||||||||||||||||||||||| ||||| |||||||||||| |
|
|
| T |
41252864 |
ttactctttaatcttattaggtttgcaacaactaaacctagaaa |
41252821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 172 - 217
Target Start/End: Complemental strand, 15969417 - 15969372
Alignment:
| Q |
172 |
tatcccttactctttaatcttattaggtttgaaacaattaaaccta |
217 |
Q |
| |
|
||||| ||| ||||||||||||||||||||| ||||| |||||||| |
|
|
| T |
15969417 |
tatcctttattctttaatcttattaggtttgcaacaactaaaccta |
15969372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 172 - 221
Target Start/End: Complemental strand, 34988757 - 34988708
Alignment:
| Q |
172 |
tatcccttactctttaatcttattaggtttgaaacaattaaacctagaaa |
221 |
Q |
| |
|
||||| |||||||||||| |||||||||||| || || |||||||||||| |
|
|
| T |
34988757 |
tatcctttactctttaatattattaggtttgcaaaaactaaacctagaaa |
34988708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 37; Significance: 0.000000000007; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 173 - 221
Target Start/End: Original strand, 44229687 - 44229735
Alignment:
| Q |
173 |
atcccttactctttaatcttattaggtttgaaacaattaaacctagaaa |
221 |
Q |
| |
|
|||| ||||||||||||||||||||||||| ||||| |||||||||||| |
|
|
| T |
44229687 |
atcctttactctttaatcttattaggtttgcaacaactaaacctagaaa |
44229735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 172 - 221
Target Start/End: Complemental strand, 15782981 - 15782932
Alignment:
| Q |
172 |
tatcccttactctttaatcttattaggtttgaaacaattaaacctagaaa |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||| |||| |||||| |
|
|
| T |
15782981 |
tatcccttactctttaatcttattaggtttgcaacaacgaaacttagaaa |
15782932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 178 - 217
Target Start/End: Complemental strand, 10186119 - 10186080
Alignment:
| Q |
178 |
ttactctttaatcttattaggtttgaaacaattaaaccta |
217 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
10186119 |
ttactctttaatcttattaggtttgcaacaattaaaccta |
10186080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 172 - 217
Target Start/End: Complemental strand, 7332376 - 7332331
Alignment:
| Q |
172 |
tatcccttactctttaatcttattaggtttgaaacaattaaaccta |
217 |
Q |
| |
|
|||||||||||||||||| |||||||||||| ||||| |||||||| |
|
|
| T |
7332376 |
tatcccttactctttaattttattaggtttgcaacaactaaaccta |
7332331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University