View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5673_low_12 (Length: 236)
Name: NF5673_low_12
Description: NF5673
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5673_low_12 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 10 - 218
Target Start/End: Complemental strand, 40699558 - 40699348
Alignment:
| Q |
10 |
agtagcaaaggcaatgac---agtggcaatggattagtatgttatgacgagggcgagggcaagacaatgatgagaggggaggtcatataggtcggaacag |
106 |
Q |
| |
|
|||||||| ||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40699558 |
agtagcaatggcaatgacgtcagtggcaatggattagtatgttatgacgagggcgaaggcaagacaatgatgagaggggaggtcatataggtcggaacag |
40699459 |
T |
 |
| Q |
107 |
aggaggaatagggaaatttgagaaagatggctactttgannnnnnnattaaataaatacttgttttttaattttaaatctaaaccttaggtagagtgctt |
206 |
Q |
| |
|
||||||||||||||||||| |||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40699458 |
aggaggaatagggaaatttaagaaagatggttactttga-ttttttattaaataaatacttgttttttaattttaaatctaaaccttaggtagagtgctt |
40699360 |
T |
 |
| Q |
207 |
ctccaaatggtc |
218 |
Q |
| |
|
|||||||||||| |
|
|
| T |
40699359 |
ctccaaatggtc |
40699348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 153 - 186
Target Start/End: Complemental strand, 45560031 - 45559998
Alignment:
| Q |
153 |
attaaataaatacttgttttttaattttaaatct |
186 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
45560031 |
attaaataaatacttgttttttaattttaaatct |
45559998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 153 - 188
Target Start/End: Complemental strand, 27923296 - 27923260
Alignment:
| Q |
153 |
attaaataaatacttgtt-ttttaattttaaatctaa |
188 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||| |
|
|
| T |
27923296 |
attaaataaatacttgtttttttaattttaaatctaa |
27923260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University