View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5673_low_4 (Length: 373)
Name: NF5673_low_4
Description: NF5673
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5673_low_4 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 332; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 332; E-Value: 0
Query Start/End: Original strand, 9 - 373
Target Start/End: Complemental strand, 49623790 - 49623425
Alignment:
| Q |
9 |
agcagagatctcgtgtcaagtcgatccgccacttgtgcagcgttcttcttcattgtctcatggtaactttccaattatcatatttagtaaagagtagatt |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49623790 |
agcagagatctcgtgtcaagtcgatccgccacttgtgcagcgttcttcttcattgtctcatggtaactttccaattatcatatttagtaaagagtagatt |
49623691 |
T |
 |
| Q |
109 |
gttcatggttaattaaaggggaaattaaaaatatggtattgtgatggttgacctagaccaaatatata--tataattgagatgaactttttggcttttag |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
49623690 |
gttcatggttaattaaaggggaaattaaaaatatggtattgtgatggttgacctagaccaaatatatatatataattgagatgaattttttggcttttag |
49623591 |
T |
 |
| Q |
207 |
tttgagttcatatgttattgtgttatcaggattgttttcttggcagcagaagcgtgcttgttggcagcatctgttatgaatgcaatccaaaattcgtatc |
306 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
49623590 |
tttgagttcatatgttattgtgttatcaggattgttttcttggcagcagaagcatgcttgctggcagcatctgttatgaatgcaatccaaaatgcgtat- |
49623492 |
T |
 |
| Q |
307 |
ttaatgagtattttttagggcatgatttgtcttgcctcatactcagcaaaggtgtgtttgctgctgg |
373 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49623491 |
ttaatgagtattttttagggcatgatttgtcttgcctcatactcagcaaaggtgtgtttgctgctgg |
49623425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 41; Significance: 0.00000000000004; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 51 - 145
Target Start/End: Complemental strand, 14335678 - 14335588
Alignment:
| Q |
51 |
ttcttcttcattgtctcatggtaactttccaattatcatatttagtaaagagtagattgttcatggttaattaaaggggaaattaaaaatatggt |
145 |
Q |
| |
|
||||||| | || ||||||||||||||||||||||||| || ||||||||||||||| |||| ||||||||| | ||||||||||||| |||| |
|
|
| T |
14335678 |
ttcttctacgttctctcatggtaactttccaattatca-at---gtaaagagtagattgctcatagttaattaaggaggaaattaaaaatgtggt |
14335588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University