View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5674_high_10 (Length: 278)
Name: NF5674_high_10
Description: NF5674
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5674_high_10 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 125; Significance: 2e-64; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 54 - 236
Target Start/End: Complemental strand, 4176428 - 4176239
Alignment:
| Q |
54 |
cacatgaaacaagtaaaatatatgattaaaaatcacaaaatgttgcatacaagttttacatnnnnnnnnn-------tgttgaaaaatcataaactaaca |
146 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
4176428 |
cacatgaaacaagtaaaatatatgattaaaaatcacaaaatgttgcatacaagttttacataaaaaaaaaaaaaaaatgttgaaaaatcataaaataaca |
4176329 |
T |
 |
| Q |
147 |
agcaagtgaagtcatacacaatttagtgaatttaatttacacatgcaacccttcctactcaaatgactcatcatagtcgatgaattgaac |
236 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
4176328 |
agcaagtgaagtcatacacaatttagtgaatttaatttacacatgcaacccctcctactcaaatgactcatcacagtcgatgaattgaac |
4176239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University