View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5674_high_11 (Length: 250)
Name: NF5674_high_11
Description: NF5674
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5674_high_11 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 15 - 250
Target Start/End: Complemental strand, 636603 - 636368
Alignment:
| Q |
15 |
atccaaagaagcagcacttcttgaagctgagaggactgttcaggttgccttgcataagcttgtaattgtgtaagtttagttgcttgggtgtgatttcaat |
114 |
Q |
| |
|
||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
636603 |
atccaaataagaagcacttcttgaagctgagaggactgttcaggttgccttgcataagcttgtaattgtgtaagtttagttgcttgggtgtgatttcaat |
636504 |
T |
|
| Q |
115 |
catttaaccagtgttattaggtactgatattgttctagtggtcaaatcaagttggtgttatatcaattttttccactcgtatttttaggaaaggaagtta |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
636503 |
catttaaccagtgttattaggtactgatattgttctagtggtcaaatcaagttggtgttatatcaattttttccactcgtatttttaggaaaggaagtta |
636404 |
T |
|
| Q |
215 |
aaatgattttgtaatgctgcgagtattttgaaattc |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
636403 |
aaatgattttgtaatgctgcgagtattttgaaattc |
636368 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 44; Significance: 4e-16; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 15 - 66
Target Start/End: Original strand, 44454102 - 44454153
Alignment:
| Q |
15 |
atccaaagaagcagcacttcttgaagctgagaggactgttcaggttgccttg |
66 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||| |||||||||||||||| |
|
|
| T |
44454102 |
atccaaagaagcagcacttcttgaagttgagaggagtgttcaggttgccttg |
44454153 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 15 - 66
Target Start/End: Original strand, 11574770 - 11574821
Alignment:
| Q |
15 |
atccaaagaagcagcacttcttgaagctgagaggactgttcaggttgccttg |
66 |
Q |
| |
|
|||||||||||| ||||| ||||||||||| | |||||||||| |||||||| |
|
|
| T |
11574770 |
atccaaagaagctgcactacttgaagctgaaaagactgttcagtttgccttg |
11574821 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University