View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5674_high_16 (Length: 222)
Name: NF5674_high_16
Description: NF5674
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5674_high_16 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 73; Significance: 2e-33; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 127 - 199
Target Start/End: Complemental strand, 2169908 - 2169836
Alignment:
| Q |
127 |
aaatcttatgtttatgtaaatgcttgtataataattatgctttagtttctttctcaaagtgaaaaactagctc |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2169908 |
aaatcttatgtttatgtaaatgcttgtataataattatgctttagtttctttctcaaagtgaaaaactagctc |
2169836 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 19 - 62
Target Start/End: Complemental strand, 2170016 - 2169973
Alignment:
| Q |
19 |
gtggtttggattgaatagattgttaaacacatttagtaatgact |
62 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2170016 |
gtggtttggattgaatagattgttaaacacatttagtaatgact |
2169973 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University