View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5674_high_17 (Length: 219)

Name: NF5674_high_17
Description: NF5674
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5674_high_17
NF5674_high_17
[»] chr5 (1 HSPs)
chr5 (16-202)||(36628152-36628338)


Alignment Details
Target: chr5 (Bit Score: 134; Significance: 6e-70; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 134; E-Value: 6e-70
Query Start/End: Original strand, 16 - 202
Target Start/End: Complemental strand, 36628338 - 36628152
Alignment:
16 gagacactacaaaaacaaattcaaaaattgatttggtcataccgataacaaagcaaatgtatctctttcctaaaataatacactttggtcaactgtgtga 115  Q
    |||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||    
36628338 gagacactgcaaaaacaaattcaaaaattgatttggtgataccgataacaaagcaaatgtatctttttcctaaaataatacactttggtcaactgtgtga 36628239  T
116 nnnnnnnnnnnaccaaaacatacgttagttcatgcttcatactagtcttaatcttataatttatgcactatataaccacttgtggta 202  Q
               ||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36628238 tttttttttttaccaaaagatacgtttgttcatgcttcatactagtcttaatcttataatttatgcactatataaccacttgtggta 36628152  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University