View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5674_low_10 (Length: 278)

Name: NF5674_low_10
Description: NF5674
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5674_low_10
NF5674_low_10
[»] chr8 (1 HSPs)
chr8 (54-236)||(4176239-4176428)


Alignment Details
Target: chr8 (Bit Score: 125; Significance: 2e-64; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 54 - 236
Target Start/End: Complemental strand, 4176428 - 4176239
Alignment:
54 cacatgaaacaagtaaaatatatgattaaaaatcacaaaatgttgcatacaagttttacatnnnnnnnnn-------tgttgaaaaatcataaactaaca 146  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||                ||||||||||||||||| |||||    
4176428 cacatgaaacaagtaaaatatatgattaaaaatcacaaaatgttgcatacaagttttacataaaaaaaaaaaaaaaatgttgaaaaatcataaaataaca 4176329  T
147 agcaagtgaagtcatacacaatttagtgaatttaatttacacatgcaacccttcctactcaaatgactcatcatagtcgatgaattgaac 236  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||    
4176328 agcaagtgaagtcatacacaatttagtgaatttaatttacacatgcaacccctcctactcaaatgactcatcacagtcgatgaattgaac 4176239  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University