View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5674_low_19 (Length: 204)
Name: NF5674_low_19
Description: NF5674
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5674_low_19 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 130; Significance: 1e-67; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 130; E-Value: 1e-67
Query Start/End: Original strand, 16 - 193
Target Start/End: Complemental strand, 36628416 - 36628239
Alignment:
| Q |
16 |
gagcacagaatcatcactagtataacttacttgacaaagataatgcattgttatgtacaaggtttgaagttcgaacctgagacactacaaaaacaaattc |
115 |
Q |
| |
|
||||||| ||||||||| |||||||| |||||||| |||||||||||| |||| | |||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
36628416 |
gagcacacaatcatcaccggtataactcacttgacagagataatgcattattatatgtaaggtttgaagttcgaacctgagacactgcaaaaacaaattc |
36628317 |
T |
 |
| Q |
116 |
aaaaattgatttggtcataccgataacaaagcaaatgtatctctttcctaaaataatacactttggtcaactgtgtga |
193 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
36628316 |
aaaaattgatttggtgataccgataacaaagcaaatgtatctttttcctaaaataatacactttggtcaactgtgtga |
36628239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University