View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5675_high_5 (Length: 368)
Name: NF5675_high_5
Description: NF5675
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5675_high_5 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 310; Significance: 1e-174; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 310; E-Value: 1e-174
Query Start/End: Original strand, 16 - 352
Target Start/End: Original strand, 28199430 - 28199767
Alignment:
| Q |
16 |
atcacttagtagcaaattaatccacaaattatatccattactagcaaattagtccctgaattatatcacctataatcaaactagctgaattatatcgctt |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28199430 |
atcacttagtagcaaattaatccacaaattatatcgattactagcaaattagtccctgaattatatcacctataatcaaactagctgaattatatcgctt |
28199529 |
T |
 |
| Q |
116 |
attgtcaaattagtccttacaggtaacaaaatgaccaagttgcccaaattcattcaaaatcaaata-ttttttgcttatttgcagatttcaagagggtaa |
214 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
28199530 |
attgtcaaattagtccttacaagtaacaaaatgaccaagttgcccaaattcattcaaaatcaaatatttttttgcttatttgcagatttcaagagggtaa |
28199629 |
T |
 |
| Q |
215 |
atgtttcaatctctagaatttcatgggaataatttccttgagatagagaactgaattaacctaatttgaagttgaataaagggaaatgaatgttacctga |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
28199630 |
atgtttcaatctctagaatttcatgggaataatttccttatgatagagaactgaattaacctaatttgaagttgaataaagggaaatggatgttacctga |
28199729 |
T |
 |
| Q |
315 |
tgccttttgcgggcattgttggagatggcagtgagaac |
352 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28199730 |
tgccttttgcgggcattgttggagatggcagtgagaac |
28199767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 42 - 83
Target Start/End: Complemental strand, 41688494 - 41688453
Alignment:
| Q |
42 |
aattatatccattactagcaaattagtccctgaattatatca |
83 |
Q |
| |
|
||||||||| ||||||||||||| ||||| |||||||||||| |
|
|
| T |
41688494 |
aattatatcaattactagcaaatcagtccatgaattatatca |
41688453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University