View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5675_low_10 (Length: 257)
Name: NF5675_low_10
Description: NF5675
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5675_low_10 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 167; Significance: 2e-89; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 167; E-Value: 2e-89
Query Start/End: Original strand, 22 - 212
Target Start/End: Complemental strand, 35032440 - 35032250
Alignment:
| Q |
22 |
tatatattttgtaaatacatgatcttgatcatcatctttacatgtatcagagtaaagagagtatataaatacctcggaataatcagaagaaggagaagat |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||| |
|
|
| T |
35032440 |
tatatattttgtaaatacatgatcttgatcatcatctttacatgtatcagagtaaagagagtatataaatacctcggaataatcaggagaaggaggagat |
35032341 |
T |
 |
| Q |
122 |
tcatttaaatcgatcaaatctcttctcttcttttgtttagcagagcaaccaacttcagtgttcgatacttgattttcattattgttgttgt |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||| |||||||| ||||| ||||||||||||||||||||||||||| |
|
|
| T |
35032340 |
tcatttaaatcgatcaaatctcttctcttcttttgtttagcagaacaatcaacttcaatgttcaatacttgattttcattattgttgttgt |
35032250 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University