View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5675_low_6 (Length: 349)
Name: NF5675_low_6
Description: NF5675
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5675_low_6 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 319; Significance: 1e-180; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 319; E-Value: 1e-180
Query Start/End: Original strand, 19 - 349
Target Start/End: Complemental strand, 42453774 - 42453444
Alignment:
| Q |
19 |
catctgtgttacaactcttccagctgaaactcttaatcgatcatatctatgcatcaaaatgatgtcttcgaatttggatggcattggatcaaactcttct |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42453774 |
catctgtgttacaactcttccagctgaaactcttaatcgatcatatctatgcatcaaaatgatgtcttcgaatttggatggcattggatcaaactcttct |
42453675 |
T |
 |
| Q |
119 |
tgcaattcatcttcacttgctgtatgcacatgagacaaatgcaaatctgcatgggataatgtttttggctttatttgaaattccagcagcatatggacta |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
42453674 |
tgcaattcatcttcacttgctgtatgcacatgagacaaatgcaaatctgcatgggataatgtttttggctttatttgaaattcctgcagcatatggacta |
42453575 |
T |
 |
| Q |
219 |
taagagcaagaaatattgctggcaacaacgattgaggcagaaagaacaagacgacgagcaacaaatgagctataattggtgaaacaagatctttccacat |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| | |
|
|
| T |
42453574 |
taagagcaagaaatattgctggcaacaacgattgaggcagaaagaacaagacgacgagcaacaagtgagctataattggtgaaacaagatctttccactt |
42453475 |
T |
 |
| Q |
319 |
gcgtacgtcatcaaaataagtgtaaatacca |
349 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
42453474 |
gcgtacgtcatcaaaataagtgtaaatacca |
42453444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University