View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5676-Insertion-1 (Length: 169)
Name: NF5676-Insertion-1
Description: NF5676
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5676-Insertion-1 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 122; Significance: 7e-63; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 122; E-Value: 7e-63
Query Start/End: Original strand, 12 - 169
Target Start/End: Original strand, 38207215 - 38207377
Alignment:
| Q |
12 |
gaaacttctctc-agaatattgtgttgaatacttctctattttaatccttcaaacgtcgccacttgattcgtagagcctgctgtaacttattgtcatata |
110 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38207215 |
gaaacttctctctagaatattgtgttgaatacttatctattttcatccttcaaacgtcgccacttgattcgtagagcctgctgtaacttattgtcatata |
38207314 |
T |
|
| Q |
111 |
tatacgactatatcattgcacaacttata----tgacatggataactatttcaacgttactgc |
169 |
Q |
| |
|
||||||||||||||||||||||||||||| | |||| ||||||||||||||||||||||| |
|
|
| T |
38207315 |
tatacgactatatcattgcacaacttatataactaacatagataactatttcaacgttactgc |
38207377 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University