View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5676_high_11 (Length: 444)
Name: NF5676_high_11
Description: NF5676
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5676_high_11 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 384; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 384; E-Value: 0
Query Start/End: Original strand, 10 - 428
Target Start/End: Complemental strand, 48153765 - 48153338
Alignment:
| Q |
10 |
attattctgtacattatgtctgaagtttctctttattatgaagtggatatcgaactgctccaatgcatgtggcagaagctgatcaagctcaccttgctgg |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48153765 |
attattctgtacattatgtctgaagtttctctttgttatgaagtggatatcgaactgctccaatgcatgtggcagaagctgatcaagctcaccttgctgg |
48153666 |
T |
 |
| Q |
110 |
ccgaaggggccgtgg---------gcatgggcgtggtcatgttcttatgcctgtggttgagggaccatatccgcaacatccagaagccgatcaagctcac |
200 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48153665 |
ccgaaggggccgtggtggccgtgggcatgggcgtggtcatgttcttatgcctgtggttgagggaccatatccgcaacatccagaagccgatcaagctcac |
48153566 |
T |
 |
| Q |
201 |
cttgctggtggaaggggccgtggtgggcgtggtcgtgttcgtaggcgctatgatacacctctaccaccaattgaacccgtctttgattttattaggactc |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48153565 |
cttgctggtggaaggggccgtggtgggcgtggtcgtgttcgtaggcgctatgatacacctctaccaccaattgaacccgtctttgattttattaggactc |
48153466 |
T |
 |
| Q |
301 |
aagtagcctttcttgagactatggttgacaacaaggtagaaactaaggtgaaagctgttgtggatactaggttcgatgccctagagcatctcatccgtaa |
400 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
48153465 |
aagtagcctctcttgagactatggttgacaacaaggtagaaactaaggtgaaagctgttgtggatcctaggttcgatgccctagagcatctcatccgtaa |
48153366 |
T |
 |
| Q |
401 |
tgttacccgcaattaaagatgttaagat |
428 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
48153365 |
tgttacccgcaattaaagatgttaagat |
48153338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University