View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5676_high_22 (Length: 348)
Name: NF5676_high_22
Description: NF5676
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5676_high_22 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 142; Significance: 2e-74; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 142; E-Value: 2e-74
Query Start/End: Original strand, 89 - 310
Target Start/End: Complemental strand, 17804942 - 17804723
Alignment:
| Q |
89 |
tcttatattcatttttatgcaactcatgcaaatatagtggttaatagagtatacctttgggtagaagccaccatatgcataaaaatggttaaacagcaac |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||| |
|
|
| T |
17804942 |
tcttatattcatttttatgcaactcatgcaaatatagtggttaatagagtatacctttgggtagaagccaccatatacataaaaatggttaaacagaaac |
17804843 |
T |
|
| Q |
189 |
catctcnnnnnnnnnnnnnnnnnnngcactgtccatgtggtcctcttatagaggttgaagcaatttggagtactttctttttcttatatcataaaaagaa |
288 |
Q |
| |
|
|||||| |||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
17804842 |
catctcaaaaaatgacataaaaaaagcactgtccaagtggtcctcttatagaggttgaagca--ttggagtactttctttttcttatatcataaaaagaa |
17804745 |
T |
|
| Q |
289 |
taaattgacgatttaataattt |
310 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
17804744 |
taaattgacgatttaataattt |
17804723 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University