View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5676_high_36 (Length: 253)
Name: NF5676_high_36
Description: NF5676
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5676_high_36 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 157; Significance: 1e-83; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 81 - 249
Target Start/End: Complemental strand, 43170640 - 43170472
Alignment:
| Q |
81 |
gtgtttgtgaaaatgattttgcagagttgtgagataactttgaatgccacagatatcttggaatgtttccccttgaatttattagactggggtagaactg |
180 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
43170640 |
gtgtttgtgaaaatgattttgcagagttgtgagataactttgaatgccacagatatcttggaatgtttccccttgaatttattagattggggtagaactg |
43170541 |
T |
|
| Q |
181 |
gtgtcctttccatagcactcaatgatacagttgttctttgtagtgattccgatggttcctatgattctg |
249 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
43170540 |
gtgtcctttccatagcactcaatgatatagttgttctttgtagtgattccgatggtttctatgattctg |
43170472 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 81 - 249
Target Start/End: Original strand, 43217696 - 43217864
Alignment:
| Q |
81 |
gtgtttgtgaaaatgattttgcagagttgtgagataactttgaatgccacagatatcttggaatgtttccccttgaatttattagactggggtagaactg |
180 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
43217696 |
gtgtttgtgaaaatgattttgcagagttgtgagataactttgaatgccacagatatcttggaatgtttccccttgaatttattagattggggtagaactg |
43217795 |
T |
|
| Q |
181 |
gtgtcctttccatagcactcaatgatacagttgttctttgtagtgattccgatggttcctatgattctg |
249 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
43217796 |
gtgtcctttccatagcactcaatgatattgttgttctttgtagtgattccgatggtttctatgattctg |
43217864 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 1 - 68
Target Start/End: Original strand, 43217454 - 43217522
Alignment:
| Q |
1 |
ttgaaatcggtccatgtcgtagttgtaatattta-tttgtccattctacataccataaggactaatttt |
68 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||| |
|
|
| T |
43217454 |
ttgaaatcggtccatgtcgtagttgtaatatttattttgtccattctacatacaataaggactaatttt |
43217522 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University