View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5676_high_44 (Length: 239)
Name: NF5676_high_44
Description: NF5676
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5676_high_44 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 168; Significance: 4e-90; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 1 - 208
Target Start/End: Complemental strand, 2560068 - 2559860
Alignment:
| Q |
1 |
tgattttgcattaaagggtatagtatgacaccttaaatgaatgtgacatttgatatgatgtacattaatgttataataatttatgcatttcatgtcaact |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2560068 |
tgattttgcattaaagggtatagtatgacaccttaaatgaatgtgacatttgatttgatgtacattaatgttataataatttatgcatttcatgtcaact |
2559969 |
T |
 |
| Q |
101 |
ttagtgcttccttc-nnnnnnntatgtcaactttagtgctctcatctcatagtctttaatgtatcgtgttaaaggttaccatgatagatttcacacatct |
199 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2559968 |
ttagtgcttccttcaaaaaaaaaatgtcaactttagtgctctcatctcatagtctttcatgtatcgtgttaaaggttaccatgatagatttcacacatct |
2559869 |
T |
 |
| Q |
200 |
ctctccccc |
208 |
Q |
| |
|
||||||||| |
|
|
| T |
2559868 |
ctctccccc |
2559860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University