View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5676_high_53 (Length: 219)
Name: NF5676_high_53
Description: NF5676
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5676_high_53 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 16 - 219
Target Start/End: Original strand, 7876217 - 7876420
Alignment:
| Q |
16 |
atgctataagaataatatacaatttgtccttcaacagtgaagtttgtccacacatggtatctgtcaattgcatcccaaaattgctaccttttttcaaaga |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7876217 |
atgctataagaataatatacaatttgtccttcaacagtgaagtttgtccacacatggtatctgtcaattgcatcccaaaattgctaccttttttcaaaga |
7876316 |
T |
 |
| Q |
116 |
cagagctgttttgagatactgcatatatatattgaaaaacatttgtgatactgaagaaggtagaaattctattgctgaaacaaagggatgcataagttct |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7876317 |
cagagctgttttgagatactgcatatatatattgaaaaacatttgtgatactgaagaaggtagaaattctattgctgaaacaaagggatgcataagttct |
7876416 |
T |
 |
| Q |
216 |
attg |
219 |
Q |
| |
|
|||| |
|
|
| T |
7876417 |
attg |
7876420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University