View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5676_high_54 (Length: 218)
Name: NF5676_high_54
Description: NF5676
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5676_high_54 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 183; Significance: 4e-99; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 1 - 214
Target Start/End: Original strand, 43217862 - 43218073
Alignment:
| Q |
1 |
ctgttgctctccctacaacgctggaagatggtcctatcacaagtgttagctgggagccagatggacacatttaagccattggtttcatgaattccattgt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||| |||||||||||||| |
|
|
| T |
43217862 |
ctgttgctctccctacaacgctggaagatggtcctatcacaagtgttagctggcagccagatggacacattttagccattggtttgatgaattccattgt |
43217961 |
T |
|
| Q |
101 |
ccagctctgggatacatctactatgacacgggtaaatgctgctcgtgttctttgtattgtttttaaacttgaaattgttctctactctcatgtttgtgtg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
43217962 |
ccagctctgggatacatctactatgacacgggtaaa--ctgcttgtgttctttgtattgtttttaaacttgaaattgttctctattctcatgtttgtgtg |
43218059 |
T |
|
| Q |
201 |
gttttattttggtc |
214 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
43218060 |
gttttattttggtc |
43218073 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 1 - 214
Target Start/End: Complemental strand, 43170474 - 43170263
Alignment:
| Q |
1 |
ctgttgctctccctacaacgctggaagatggtcctatcacaagtgttagctgggagccagatggacacatttaagccattggtttcatgaattccattgt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||| |||||||||||||| |
|
|
| T |
43170474 |
ctgttgctctccctacaacgctggaagatggtcctatcacaagtgttagctggcagccagatggacacattttagccattggtttgatgaattccattgt |
43170375 |
T |
|
| Q |
101 |
ccagctctgggatacatctactatgacacgggtaaatgctgctcgtgttctttgtattgtttttaaacttgaaattgttctctactctcatgtttgtgtg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||| ||||||| ||||||||||||||| |
|
|
| T |
43170374 |
ccagctctgggatacatctactatgacacgggtaaa--ctgcttgtgttctttgtattgtttttaaacttgaaatttttctctattctcatgtttgtgtg |
43170277 |
T |
|
| Q |
201 |
gttttattttggtc |
214 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
43170276 |
gttttattttggtc |
43170263 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University