View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5676_high_56 (Length: 216)
Name: NF5676_high_56
Description: NF5676
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5676_high_56 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 121; Significance: 4e-62; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 88 - 216
Target Start/End: Original strand, 17355838 - 17355966
Alignment:
| Q |
88 |
tcatatttgttttttgggcttatgtttcttgattttcttttaagaaagaacaagatcttgtattggtatggctaccattacaaatcttgtgggtcatatc |
187 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||| |
|
|
| T |
17355838 |
tcatatttgttttttgggcttatgtttcttgattttcttttaagaaagaacaagatcttgtattggtatggctaccattacaaatcttatgggtcttatc |
17355937 |
T |
 |
| Q |
188 |
tttcatttcttgatcaattgtcgtgaatc |
216 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
17355938 |
tttcatttcttgatcaattgtcgtgaatc |
17355966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University