View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5676_low_20 (Length: 369)
Name: NF5676_low_20
Description: NF5676
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5676_low_20 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 310; Significance: 1e-174; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 310; E-Value: 1e-174
Query Start/End: Original strand, 10 - 351
Target Start/End: Original strand, 2222878 - 2223219
Alignment:
| Q |
10 |
aataatattgttgccgacaatattaataaatctaaagaaattgagcggcgttacgatgattatagaaggaagagaaagcgtccatgcaaagtggcggtgg |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
2222878 |
aataatattgttgccgacaatattaataaatctaaagaaattgagcggcgttacgatgattatagaaggaagagaaagcgtccatgcaaagtggcagtgg |
2222977 |
T |
|
| Q |
110 |
gtcctacgatggaatcaaccaccggagaaaccgccaccacgtcacatggttttatatcggtgattgggcggaggagggtgatggaagatgctattaaggt |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2222978 |
ttcctacgatggaatcaaccaccggagaaaccgccaccgcgtcacatggttttatatcggtgattgggcggaggagggtgatggaagatgctattaaggt |
2223077 |
T |
|
| Q |
210 |
gattccacgttttgtggcgacggagcagaacctgtgcggttatgatttctttgcggtttatgacggtcatggtggtatgacggtggcgaatgcttgccgt |
309 |
Q |
| |
|
||||||||||||||||||| |||||||| | | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2223078 |
gattccacgttttgtggcggcggagcagcaaccgtgcggttatgatttctttgcggtttatgacggtcatggtggtatgacggtggcgaatgcttgccgt |
2223177 |
T |
|
| Q |
310 |
gataggctgcacttgttgttggcggaggaagtgaaggagggt |
351 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
2223178 |
gataggttgcacttgttgttggcggaggaagtgaaggagggt |
2223219 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University